Review



stepone real time pcr machine  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher stepone real time pcr machine
    Stepone Real Time Pcr Machine, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stepone+real-time+pcr+system/SUCROSE+EP%2FBP%2FNF+12KG/pm41806351-84-11-9
    Average 99 stars, based on 1 article reviews
    stepone real time pcr machine - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: CIAO1 as a crucial signature gene of cuproptosis in gastric cancer
    Article Snippet: Reverse transcription was carried out using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics) with the following thermal protocol: 10 min at 65°C for primer annealing, 30 min at 55°C for reverse transcription, and 5 min at 85°C for enzyme inactivation. qPCR was performed using PowerUp SYBRTM Green Master Mix (Thermo Fisher Scientific, Inc.) on the StepOne Real-Time PCR System (Thermo Fisher Scientific, Inc.).

    Article Title: Prediction of long-term recurrence-free and overall survival in early-onset colorectal cancer: the ENCORE multi-centre study
    Article Snippet: In both cohorts, miRNA expression was assessed by RT-qPCR on a StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA) using the TaqMan miRNA probes (ThermoFisher Scientific, Supplementary Table ).

    Article Title: Neu1 sialidase regulates heterospecific social interaction in zebrafish via D1 dopamine receptor.
    Article Snippet: Gene expression levels were evaluated using a StepOne Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA).

    Article Title: Vagus nerve stimulation: a promising strategy to combat pyroptosis and inflammation in traumatic brain injury through the OX-A/NLRP3/caspase-1/GSDMD signaling pathway.
    Article Snippet: The amplification process was performed on cDNA (50 ng/μL) utilizing the StepOne Real-Time PCR System (Thermo Fisher Scientific), with SYBR Green PCR Master Mix in the presence of a specific primer pair (see Table 1) at 0.1 μM, according to the manufacturer’s instructions (TransGen Biotech).

    Article Title: SOX3 facilitates granulosa cell proliferation and suppresses cell apoptosis through modulating PI3K/AKT pathway by targeting SPP1.
    Article Snippet: Then the RNA samples were reverse transcribed using the RevertAid RT Reverse Transcription Kit (K1691, Thermo Fisher, USA) according to the manufacturer’s protocol. qRT-PCR assays were performed using SYBR Green qPCR Mix (D01010, GeneCopoeia, USA) in a StepOne real-time PCR system (Applied Biosystems, USA) following the routine protocol.

    Article Title: Effects of estrogen and mechanical loading on cultured cells derived from mandibular condylar cartilage.
    Article Snippet: The mRNA expression levels were measured using a StepOne Real-Time PCR System (Thermo Fisher Scientific). β-actin (used as an internal standard) and four target genes—IL-1β, MMP13, ADAMTS5, TIMP3, and COL2A1—were identified using the MCC method to assess the gene expression levels in response to the loading model. Primers were designed for 10 genes: collagen type I alpha 1 chain (COL1A1), collagen type III alpha 1 chain (COL3A1), collagen type IV alpha 1 chain (COL4A1), collagen type V alpha 1 chain (COL5A1), collagen type IV alpha 2 chain (COL4A2), collagen type IV alpha 5 chain (COL4A5), laminin subunit gamma 1 (LAMC1), heparan sulfate proteoglycan 2 (HSPG), laminin subunit beta 1 (LAMB1), and laminin subunit alpha 3 (LAMA3) (Fig. 5c, d).

    Article Title: The structural characteristics of cellular phospholipid acyl chains required for ABCA1-mediated HDL formation.
    Article Snippet: The expression level of ABCA1 mRNA was quantified using StepOne real-time PCR system (Applied Biosystems) with PowerUP SYBR Green Master Mix (Thermo Fisher Scientific) and specific primers (for ABCA1, 5’- CAGGCTACTACCTGACCTTGGT -3’ and 5’- CTGCTCTGAGAAACACTGTCCTC -3’; for GAPDH, 5’- GCACAGTCAAGGCTGAGAA -3’ and 5’- GCCAGTAGACTCCACAACATAC -3’) and quantified using the 2-Ct method.

    Article Title: FGFR inhibitors promote the autophagic degradation of IFN-γ-induced PD-L1 and alleviate the PD-L1-mediated transcriptional suppression of FGFR3-TACC3 in non-muscle-invasive bladder cancer.
    Article Snippet: Quantitative real-time PCR (qPCR) analysis was performed on a StepOne Real-Time PCR System (Thermo Fisher Scientific) using gene-specific primers (Supplementary Table S1) and the RealQ Plus 2X Master Green (A325402; Ampliqon, Odense, Denmark).

    cDNA Synthesis:

    Article Title: CIAO1 as a crucial signature gene of cuproptosis in gastric cancer
    Article Snippet: Reverse transcription was carried out using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics) with the following thermal protocol: 10 min at 65°C for primer annealing, 30 min at 55°C for reverse transcription, and 5 min at 85°C for enzyme inactivation. qPCR was performed using PowerUp SYBRTM Green Master Mix (Thermo Fisher Scientific, Inc.) on the StepOne Real-Time PCR System (Thermo Fisher Scientific, Inc.).

    Article Title: Prediction of long-term recurrence-free and overall survival in early-onset colorectal cancer: the ENCORE multi-centre study
    Article Snippet: In both cohorts, miRNA expression was assessed by RT-qPCR on a StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA) using the TaqMan miRNA probes (ThermoFisher Scientific, Supplementary Table ).

    Article Title: Neu1 sialidase regulates heterospecific social interaction in zebrafish via D1 dopamine receptor.
    Article Snippet: Gene expression levels were evaluated using a StepOne Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA).

    Article Title: Vagus nerve stimulation: a promising strategy to combat pyroptosis and inflammation in traumatic brain injury through the OX-A/NLRP3/caspase-1/GSDMD signaling pathway.
    Article Snippet: The amplification process was performed on cDNA (50 ng/μL) utilizing the StepOne Real-Time PCR System (Thermo Fisher Scientific), with SYBR Green PCR Master Mix in the presence of a specific primer pair (see Table 1) at 0.1 μM, according to the manufacturer’s instructions (TransGen Biotech).

    Article Title: SOX3 facilitates granulosa cell proliferation and suppresses cell apoptosis through modulating PI3K/AKT pathway by targeting SPP1.
    Article Snippet: Then the RNA samples were reverse transcribed using the RevertAid RT Reverse Transcription Kit (K1691, Thermo Fisher, USA) according to the manufacturer’s protocol. qRT-PCR assays were performed using SYBR Green qPCR Mix (D01010, GeneCopoeia, USA) in a StepOne real-time PCR system (Applied Biosystems, USA) following the routine protocol.

    Article Title: Effects of estrogen and mechanical loading on cultured cells derived from mandibular condylar cartilage.
    Article Snippet: The mRNA expression levels were measured using a StepOne Real-Time PCR System (Thermo Fisher Scientific). β-actin (used as an internal standard) and four target genes—IL-1β, MMP13, ADAMTS5, TIMP3, and COL2A1—were identified using the MCC method to assess the gene expression levels in response to the loading model. Primers were designed for 10 genes: collagen type I alpha 1 chain (COL1A1), collagen type III alpha 1 chain (COL3A1), collagen type IV alpha 1 chain (COL4A1), collagen type V alpha 1 chain (COL5A1), collagen type IV alpha 2 chain (COL4A2), collagen type IV alpha 5 chain (COL4A5), laminin subunit gamma 1 (LAMC1), heparan sulfate proteoglycan 2 (HSPG), laminin subunit beta 1 (LAMB1), and laminin subunit alpha 3 (LAMA3) (Fig. 5c, d).

    Article Title: The structural characteristics of cellular phospholipid acyl chains required for ABCA1-mediated HDL formation.
    Article Snippet: The expression level of ABCA1 mRNA was quantified using StepOne real-time PCR system (Applied Biosystems) with PowerUP SYBR Green Master Mix (Thermo Fisher Scientific) and specific primers (for ABCA1, 5’- CAGGCTACTACCTGACCTTGGT -3’ and 5’- CTGCTCTGAGAAACACTGTCCTC -3’; for GAPDH, 5’- GCACAGTCAAGGCTGAGAA -3’ and 5’- GCCAGTAGACTCCACAACATAC -3’) and quantified using the 2-Ct method.

    Article Title: FGFR inhibitors promote the autophagic degradation of IFN-γ-induced PD-L1 and alleviate the PD-L1-mediated transcriptional suppression of FGFR3-TACC3 in non-muscle-invasive bladder cancer.
    Article Snippet: Quantitative real-time PCR (qPCR) analysis was performed on a StepOne Real-Time PCR System (Thermo Fisher Scientific) using gene-specific primers (Supplementary Table S1) and the RealQ Plus 2X Master Green (A325402; Ampliqon, Odense, Denmark).

    Real-time Polymerase Chain Reaction:

    Article Title: CIAO1 as a crucial signature gene of cuproptosis in gastric cancer
    Article Snippet: Reverse transcription was carried out using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics) with the following thermal protocol: 10 min at 65°C for primer annealing, 30 min at 55°C for reverse transcription, and 5 min at 85°C for enzyme inactivation. qPCR was performed using PowerUp SYBRTM Green Master Mix (Thermo Fisher Scientific, Inc.) on the StepOne Real-Time PCR System (Thermo Fisher Scientific, Inc.).

    Article Title: Prediction of long-term recurrence-free and overall survival in early-onset colorectal cancer: the ENCORE multi-centre study
    Article Snippet: In both cohorts, miRNA expression was assessed by RT-qPCR on a StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA) using the TaqMan miRNA probes (ThermoFisher Scientific, Supplementary Table ).

    Article Title: Neu1 sialidase regulates heterospecific social interaction in zebrafish via D1 dopamine receptor.
    Article Snippet: Gene expression levels were evaluated using a StepOne Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA).

    Article Title: Vagus nerve stimulation: a promising strategy to combat pyroptosis and inflammation in traumatic brain injury through the OX-A/NLRP3/caspase-1/GSDMD signaling pathway.
    Article Snippet: The amplification process was performed on cDNA (50 ng/μL) utilizing the StepOne Real-Time PCR System (Thermo Fisher Scientific), with SYBR Green PCR Master Mix in the presence of a specific primer pair (see Table 1) at 0.1 μM, according to the manufacturer’s instructions (TransGen Biotech).

    Article Title: SOX3 facilitates granulosa cell proliferation and suppresses cell apoptosis through modulating PI3K/AKT pathway by targeting SPP1.
    Article Snippet: Then the RNA samples were reverse transcribed using the RevertAid RT Reverse Transcription Kit (K1691, Thermo Fisher, USA) according to the manufacturer’s protocol. qRT-PCR assays were performed using SYBR Green qPCR Mix (D01010, GeneCopoeia, USA) in a StepOne real-time PCR system (Applied Biosystems, USA) following the routine protocol.

    Article Title: Effects of estrogen and mechanical loading on cultured cells derived from mandibular condylar cartilage.
    Article Snippet: The mRNA expression levels were measured using a StepOne Real-Time PCR System (Thermo Fisher Scientific). β-actin (used as an internal standard) and four target genes—IL-1β, MMP13, ADAMTS5, TIMP3, and COL2A1—were identified using the MCC method to assess the gene expression levels in response to the loading model. Primers were designed for 10 genes: collagen type I alpha 1 chain (COL1A1), collagen type III alpha 1 chain (COL3A1), collagen type IV alpha 1 chain (COL4A1), collagen type V alpha 1 chain (COL5A1), collagen type IV alpha 2 chain (COL4A2), collagen type IV alpha 5 chain (COL4A5), laminin subunit gamma 1 (LAMC1), heparan sulfate proteoglycan 2 (HSPG), laminin subunit beta 1 (LAMB1), and laminin subunit alpha 3 (LAMA3) (Fig. 5c, d).

    Article Title: The structural characteristics of cellular phospholipid acyl chains required for ABCA1-mediated HDL formation.
    Article Snippet: The expression level of ABCA1 mRNA was quantified using StepOne real-time PCR system (Applied Biosystems) with PowerUP SYBR Green Master Mix (Thermo Fisher Scientific) and specific primers (for ABCA1, 5’- CAGGCTACTACCTGACCTTGGT -3’ and 5’- CTGCTCTGAGAAACACTGTCCTC -3’; for GAPDH, 5’- GCACAGTCAAGGCTGAGAA -3’ and 5’- GCCAGTAGACTCCACAACATAC -3’) and quantified using the 2-Ct method.

    Article Title: FGFR inhibitors promote the autophagic degradation of IFN-γ-induced PD-L1 and alleviate the PD-L1-mediated transcriptional suppression of FGFR3-TACC3 in non-muscle-invasive bladder cancer.
    Article Snippet: Quantitative real-time PCR (qPCR) analysis was performed on a StepOne Real-Time PCR System (Thermo Fisher Scientific) using gene-specific primers (Supplementary Table S1) and the RealQ Plus 2X Master Green (A325402; Ampliqon, Odense, Denmark).

    Amplification:

    Article Title: CIAO1 as a crucial signature gene of cuproptosis in gastric cancer
    Article Snippet: Reverse transcription was carried out using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics) with the following thermal protocol: 10 min at 65°C for primer annealing, 30 min at 55°C for reverse transcription, and 5 min at 85°C for enzyme inactivation. qPCR was performed using PowerUp SYBRTM Green Master Mix (Thermo Fisher Scientific, Inc.) on the StepOne Real-Time PCR System (Thermo Fisher Scientific, Inc.).

    Article Title: Prediction of long-term recurrence-free and overall survival in early-onset colorectal cancer: the ENCORE multi-centre study
    Article Snippet: In both cohorts, miRNA expression was assessed by RT-qPCR on a StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA) using the TaqMan miRNA probes (ThermoFisher Scientific, Supplementary Table ).

    Article Title: Neu1 sialidase regulates heterospecific social interaction in zebrafish via D1 dopamine receptor.
    Article Snippet: Gene expression levels were evaluated using a StepOne Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA).

    Article Title: Vagus nerve stimulation: a promising strategy to combat pyroptosis and inflammation in traumatic brain injury through the OX-A/NLRP3/caspase-1/GSDMD signaling pathway.
    Article Snippet: The amplification process was performed on cDNA (50 ng/μL) utilizing the StepOne Real-Time PCR System (Thermo Fisher Scientific), with SYBR Green PCR Master Mix in the presence of a specific primer pair (see Table 1) at 0.1 μM, according to the manufacturer’s instructions (TransGen Biotech).

    Article Title: SOX3 facilitates granulosa cell proliferation and suppresses cell apoptosis through modulating PI3K/AKT pathway by targeting SPP1.
    Article Snippet: Then the RNA samples were reverse transcribed using the RevertAid RT Reverse Transcription Kit (K1691, Thermo Fisher, USA) according to the manufacturer’s protocol. qRT-PCR assays were performed using SYBR Green qPCR Mix (D01010, GeneCopoeia, USA) in a StepOne real-time PCR system (Applied Biosystems, USA) following the routine protocol.

    Article Title: Effects of estrogen and mechanical loading on cultured cells derived from mandibular condylar cartilage.
    Article Snippet: The mRNA expression levels were measured using a StepOne Real-Time PCR System (Thermo Fisher Scientific). β-actin (used as an internal standard) and four target genes—IL-1β, MMP13, ADAMTS5, TIMP3, and COL2A1—were identified using the MCC method to assess the gene expression levels in response to the loading model. Primers were designed for 10 genes: collagen type I alpha 1 chain (COL1A1), collagen type III alpha 1 chain (COL3A1), collagen type IV alpha 1 chain (COL4A1), collagen type V alpha 1 chain (COL5A1), collagen type IV alpha 2 chain (COL4A2), collagen type IV alpha 5 chain (COL4A5), laminin subunit gamma 1 (LAMC1), heparan sulfate proteoglycan 2 (HSPG), laminin subunit beta 1 (LAMB1), and laminin subunit alpha 3 (LAMA3) (Fig. 5c, d).

    Article Title: The structural characteristics of cellular phospholipid acyl chains required for ABCA1-mediated HDL formation.
    Article Snippet: The expression level of ABCA1 mRNA was quantified using StepOne real-time PCR system (Applied Biosystems) with PowerUP SYBR Green Master Mix (Thermo Fisher Scientific) and specific primers (for ABCA1, 5’- CAGGCTACTACCTGACCTTGGT -3’ and 5’- CTGCTCTGAGAAACACTGTCCTC -3’; for GAPDH, 5’- GCACAGTCAAGGCTGAGAA -3’ and 5’- GCCAGTAGACTCCACAACATAC -3’) and quantified using the 2-Ct method.

    Article Title: FGFR inhibitors promote the autophagic degradation of IFN-γ-induced PD-L1 and alleviate the PD-L1-mediated transcriptional suppression of FGFR3-TACC3 in non-muscle-invasive bladder cancer.
    Article Snippet: Quantitative real-time PCR (qPCR) analysis was performed on a StepOne Real-Time PCR System (Thermo Fisher Scientific) using gene-specific primers (Supplementary Table S1) and the RealQ Plus 2X Master Green (A325402; Ampliqon, Odense, Denmark).

    SYBR Green Assay:

    Article Title: CIAO1 as a crucial signature gene of cuproptosis in gastric cancer
    Article Snippet: Reverse transcription was carried out using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics) with the following thermal protocol: 10 min at 65°C for primer annealing, 30 min at 55°C for reverse transcription, and 5 min at 85°C for enzyme inactivation. qPCR was performed using PowerUp SYBRTM Green Master Mix (Thermo Fisher Scientific, Inc.) on the StepOne Real-Time PCR System (Thermo Fisher Scientific, Inc.).

    Article Title: Prediction of long-term recurrence-free and overall survival in early-onset colorectal cancer: the ENCORE multi-centre study
    Article Snippet: In both cohorts, miRNA expression was assessed by RT-qPCR on a StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA) using the TaqMan miRNA probes (ThermoFisher Scientific, Supplementary Table ).

    Article Title: Neu1 sialidase regulates heterospecific social interaction in zebrafish via D1 dopamine receptor.
    Article Snippet: Gene expression levels were evaluated using a StepOne Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA).

    Article Title: Vagus nerve stimulation: a promising strategy to combat pyroptosis and inflammation in traumatic brain injury through the OX-A/NLRP3/caspase-1/GSDMD signaling pathway.
    Article Snippet: The amplification process was performed on cDNA (50 ng/μL) utilizing the StepOne Real-Time PCR System (Thermo Fisher Scientific), with SYBR Green PCR Master Mix in the presence of a specific primer pair (see Table 1) at 0.1 μM, according to the manufacturer’s instructions (TransGen Biotech).

    Article Title: SOX3 facilitates granulosa cell proliferation and suppresses cell apoptosis through modulating PI3K/AKT pathway by targeting SPP1.
    Article Snippet: Then the RNA samples were reverse transcribed using the RevertAid RT Reverse Transcription Kit (K1691, Thermo Fisher, USA) according to the manufacturer’s protocol. qRT-PCR assays were performed using SYBR Green qPCR Mix (D01010, GeneCopoeia, USA) in a StepOne real-time PCR system (Applied Biosystems, USA) following the routine protocol.

    Article Title: Effects of estrogen and mechanical loading on cultured cells derived from mandibular condylar cartilage.
    Article Snippet: The mRNA expression levels were measured using a StepOne Real-Time PCR System (Thermo Fisher Scientific). β-actin (used as an internal standard) and four target genes—IL-1β, MMP13, ADAMTS5, TIMP3, and COL2A1—were identified using the MCC method to assess the gene expression levels in response to the loading model. Primers were designed for 10 genes: collagen type I alpha 1 chain (COL1A1), collagen type III alpha 1 chain (COL3A1), collagen type IV alpha 1 chain (COL4A1), collagen type V alpha 1 chain (COL5A1), collagen type IV alpha 2 chain (COL4A2), collagen type IV alpha 5 chain (COL4A5), laminin subunit gamma 1 (LAMC1), heparan sulfate proteoglycan 2 (HSPG), laminin subunit beta 1 (LAMB1), and laminin subunit alpha 3 (LAMA3) (Fig. 5c, d).

    Article Title: The structural characteristics of cellular phospholipid acyl chains required for ABCA1-mediated HDL formation.
    Article Snippet: The expression level of ABCA1 mRNA was quantified using StepOne real-time PCR system (Applied Biosystems) with PowerUP SYBR Green Master Mix (Thermo Fisher Scientific) and specific primers (for ABCA1, 5’- CAGGCTACTACCTGACCTTGGT -3’ and 5’- CTGCTCTGAGAAACACTGTCCTC -3’; for GAPDH, 5’- GCACAGTCAAGGCTGAGAA -3’ and 5’- GCCAGTAGACTCCACAACATAC -3’) and quantified using the 2-Ct method.

    Article Title: FGFR inhibitors promote the autophagic degradation of IFN-γ-induced PD-L1 and alleviate the PD-L1-mediated transcriptional suppression of FGFR3-TACC3 in non-muscle-invasive bladder cancer.
    Article Snippet: Quantitative real-time PCR (qPCR) analysis was performed on a StepOne Real-Time PCR System (Thermo Fisher Scientific) using gene-specific primers (Supplementary Table S1) and the RealQ Plus 2X Master Green (A325402; Ampliqon, Odense, Denmark).

    Polymerase Chain Reaction:

    Article Title: CIAO1 as a crucial signature gene of cuproptosis in gastric cancer
    Article Snippet: Reverse transcription was carried out using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics) with the following thermal protocol: 10 min at 65°C for primer annealing, 30 min at 55°C for reverse transcription, and 5 min at 85°C for enzyme inactivation. qPCR was performed using PowerUp SYBRTM Green Master Mix (Thermo Fisher Scientific, Inc.) on the StepOne Real-Time PCR System (Thermo Fisher Scientific, Inc.).

    Article Title: Prediction of long-term recurrence-free and overall survival in early-onset colorectal cancer: the ENCORE multi-centre study
    Article Snippet: In both cohorts, miRNA expression was assessed by RT-qPCR on a StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA) using the TaqMan miRNA probes (ThermoFisher Scientific, Supplementary Table ).

    Article Title: Neu1 sialidase regulates heterospecific social interaction in zebrafish via D1 dopamine receptor.
    Article Snippet: Gene expression levels were evaluated using a StepOne Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA).

    Article Title: Vagus nerve stimulation: a promising strategy to combat pyroptosis and inflammation in traumatic brain injury through the OX-A/NLRP3/caspase-1/GSDMD signaling pathway.
    Article Snippet: The amplification process was performed on cDNA (50 ng/μL) utilizing the StepOne Real-Time PCR System (Thermo Fisher Scientific), with SYBR Green PCR Master Mix in the presence of a specific primer pair (see Table 1) at 0.1 μM, according to the manufacturer’s instructions (TransGen Biotech).

    Article Title: SOX3 facilitates granulosa cell proliferation and suppresses cell apoptosis through modulating PI3K/AKT pathway by targeting SPP1.
    Article Snippet: Then the RNA samples were reverse transcribed using the RevertAid RT Reverse Transcription Kit (K1691, Thermo Fisher, USA) according to the manufacturer’s protocol. qRT-PCR assays were performed using SYBR Green qPCR Mix (D01010, GeneCopoeia, USA) in a StepOne real-time PCR system (Applied Biosystems, USA) following the routine protocol.

    Article Title: Effects of estrogen and mechanical loading on cultured cells derived from mandibular condylar cartilage.
    Article Snippet: The mRNA expression levels were measured using a StepOne Real-Time PCR System (Thermo Fisher Scientific). β-actin (used as an internal standard) and four target genes—IL-1β, MMP13, ADAMTS5, TIMP3, and COL2A1—were identified using the MCC method to assess the gene expression levels in response to the loading model. Primers were designed for 10 genes: collagen type I alpha 1 chain (COL1A1), collagen type III alpha 1 chain (COL3A1), collagen type IV alpha 1 chain (COL4A1), collagen type V alpha 1 chain (COL5A1), collagen type IV alpha 2 chain (COL4A2), collagen type IV alpha 5 chain (COL4A5), laminin subunit gamma 1 (LAMC1), heparan sulfate proteoglycan 2 (HSPG), laminin subunit beta 1 (LAMB1), and laminin subunit alpha 3 (LAMA3) (Fig. 5c, d).

    Article Title: The structural characteristics of cellular phospholipid acyl chains required for ABCA1-mediated HDL formation.
    Article Snippet: The expression level of ABCA1 mRNA was quantified using StepOne real-time PCR system (Applied Biosystems) with PowerUP SYBR Green Master Mix (Thermo Fisher Scientific) and specific primers (for ABCA1, 5’- CAGGCTACTACCTGACCTTGGT -3’ and 5’- CTGCTCTGAGAAACACTGTCCTC -3’; for GAPDH, 5’- GCACAGTCAAGGCTGAGAA -3’ and 5’- GCCAGTAGACTCCACAACATAC -3’) and quantified using the 2-Ct method.

    Article Title: FGFR inhibitors promote the autophagic degradation of IFN-γ-induced PD-L1 and alleviate the PD-L1-mediated transcriptional suppression of FGFR3-TACC3 in non-muscle-invasive bladder cancer.
    Article Snippet: Quantitative real-time PCR (qPCR) analysis was performed on a StepOne Real-Time PCR System (Thermo Fisher Scientific) using gene-specific primers (Supplementary Table S1) and the RealQ Plus 2X Master Green (A325402; Ampliqon, Odense, Denmark).

    Expressing:

    Article Title: CIAO1 as a crucial signature gene of cuproptosis in gastric cancer
    Article Snippet: Reverse transcription was carried out using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics) with the following thermal protocol: 10 min at 65°C for primer annealing, 30 min at 55°C for reverse transcription, and 5 min at 85°C for enzyme inactivation. qPCR was performed using PowerUp SYBRTM Green Master Mix (Thermo Fisher Scientific, Inc.) on the StepOne Real-Time PCR System (Thermo Fisher Scientific, Inc.).

    Article Title: Prediction of long-term recurrence-free and overall survival in early-onset colorectal cancer: the ENCORE multi-centre study
    Article Snippet: In both cohorts, miRNA expression was assessed by RT-qPCR on a StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA) using the TaqMan miRNA probes (ThermoFisher Scientific, Supplementary Table ).

    Article Title: Neu1 sialidase regulates heterospecific social interaction in zebrafish via D1 dopamine receptor.
    Article Snippet: Gene expression levels were evaluated using a StepOne Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA).

    Article Title: Vagus nerve stimulation: a promising strategy to combat pyroptosis and inflammation in traumatic brain injury through the OX-A/NLRP3/caspase-1/GSDMD signaling pathway.
    Article Snippet: The amplification process was performed on cDNA (50 ng/μL) utilizing the StepOne Real-Time PCR System (Thermo Fisher Scientific), with SYBR Green PCR Master Mix in the presence of a specific primer pair (see Table 1) at 0.1 μM, according to the manufacturer’s instructions (TransGen Biotech).

    Article Title: SOX3 facilitates granulosa cell proliferation and suppresses cell apoptosis through modulating PI3K/AKT pathway by targeting SPP1.
    Article Snippet: Then the RNA samples were reverse transcribed using the RevertAid RT Reverse Transcription Kit (K1691, Thermo Fisher, USA) according to the manufacturer’s protocol. qRT-PCR assays were performed using SYBR Green qPCR Mix (D01010, GeneCopoeia, USA) in a StepOne real-time PCR system (Applied Biosystems, USA) following the routine protocol.

    Article Title: Effects of estrogen and mechanical loading on cultured cells derived from mandibular condylar cartilage.
    Article Snippet: The mRNA expression levels were measured using a StepOne Real-Time PCR System (Thermo Fisher Scientific). β-actin (used as an internal standard) and four target genes—IL-1β, MMP13, ADAMTS5, TIMP3, and COL2A1—were identified using the MCC method to assess the gene expression levels in response to the loading model. Primers were designed for 10 genes: collagen type I alpha 1 chain (COL1A1), collagen type III alpha 1 chain (COL3A1), collagen type IV alpha 1 chain (COL4A1), collagen type V alpha 1 chain (COL5A1), collagen type IV alpha 2 chain (COL4A2), collagen type IV alpha 5 chain (COL4A5), laminin subunit gamma 1 (LAMC1), heparan sulfate proteoglycan 2 (HSPG), laminin subunit beta 1 (LAMB1), and laminin subunit alpha 3 (LAMA3) (Fig. 5c, d).

    Article Title: The structural characteristics of cellular phospholipid acyl chains required for ABCA1-mediated HDL formation.
    Article Snippet: The expression level of ABCA1 mRNA was quantified using StepOne real-time PCR system (Applied Biosystems) with PowerUP SYBR Green Master Mix (Thermo Fisher Scientific) and specific primers (for ABCA1, 5’- CAGGCTACTACCTGACCTTGGT -3’ and 5’- CTGCTCTGAGAAACACTGTCCTC -3’; for GAPDH, 5’- GCACAGTCAAGGCTGAGAA -3’ and 5’- GCCAGTAGACTCCACAACATAC -3’) and quantified using the 2-Ct method.

    Article Title: FGFR inhibitors promote the autophagic degradation of IFN-γ-induced PD-L1 and alleviate the PD-L1-mediated transcriptional suppression of FGFR3-TACC3 in non-muscle-invasive bladder cancer.
    Article Snippet: Quantitative real-time PCR (qPCR) analysis was performed on a StepOne Real-Time PCR System (Thermo Fisher Scientific) using gene-specific primers (Supplementary Table S1) and the RealQ Plus 2X Master Green (A325402; Ampliqon, Odense, Denmark).

    Gene Expression:

    Article Title: CIAO1 as a crucial signature gene of cuproptosis in gastric cancer
    Article Snippet: Reverse transcription was carried out using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics) with the following thermal protocol: 10 min at 65°C for primer annealing, 30 min at 55°C for reverse transcription, and 5 min at 85°C for enzyme inactivation. qPCR was performed using PowerUp SYBRTM Green Master Mix (Thermo Fisher Scientific, Inc.) on the StepOne Real-Time PCR System (Thermo Fisher Scientific, Inc.).

    Article Title: Prediction of long-term recurrence-free and overall survival in early-onset colorectal cancer: the ENCORE multi-centre study
    Article Snippet: In both cohorts, miRNA expression was assessed by RT-qPCR on a StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA) using the TaqMan miRNA probes (ThermoFisher Scientific, Supplementary Table ).

    Article Title: Neu1 sialidase regulates heterospecific social interaction in zebrafish via D1 dopamine receptor.
    Article Snippet: Gene expression levels were evaluated using a StepOne Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA).

    Article Title: Vagus nerve stimulation: a promising strategy to combat pyroptosis and inflammation in traumatic brain injury through the OX-A/NLRP3/caspase-1/GSDMD signaling pathway.
    Article Snippet: The amplification process was performed on cDNA (50 ng/μL) utilizing the StepOne Real-Time PCR System (Thermo Fisher Scientific), with SYBR Green PCR Master Mix in the presence of a specific primer pair (see Table 1) at 0.1 μM, according to the manufacturer’s instructions (TransGen Biotech).

    Article Title: SOX3 facilitates granulosa cell proliferation and suppresses cell apoptosis through modulating PI3K/AKT pathway by targeting SPP1.
    Article Snippet: Then the RNA samples were reverse transcribed using the RevertAid RT Reverse Transcription Kit (K1691, Thermo Fisher, USA) according to the manufacturer’s protocol. qRT-PCR assays were performed using SYBR Green qPCR Mix (D01010, GeneCopoeia, USA) in a StepOne real-time PCR system (Applied Biosystems, USA) following the routine protocol.

    Article Title: Effects of estrogen and mechanical loading on cultured cells derived from mandibular condylar cartilage.
    Article Snippet: The mRNA expression levels were measured using a StepOne Real-Time PCR System (Thermo Fisher Scientific). β-actin (used as an internal standard) and four target genes—IL-1β, MMP13, ADAMTS5, TIMP3, and COL2A1—were identified using the MCC method to assess the gene expression levels in response to the loading model. Primers were designed for 10 genes: collagen type I alpha 1 chain (COL1A1), collagen type III alpha 1 chain (COL3A1), collagen type IV alpha 1 chain (COL4A1), collagen type V alpha 1 chain (COL5A1), collagen type IV alpha 2 chain (COL4A2), collagen type IV alpha 5 chain (COL4A5), laminin subunit gamma 1 (LAMC1), heparan sulfate proteoglycan 2 (HSPG), laminin subunit beta 1 (LAMB1), and laminin subunit alpha 3 (LAMA3) (Fig. 5c, d).

    Article Title: The structural characteristics of cellular phospholipid acyl chains required for ABCA1-mediated HDL formation.
    Article Snippet: The expression level of ABCA1 mRNA was quantified using StepOne real-time PCR system (Applied Biosystems) with PowerUP SYBR Green Master Mix (Thermo Fisher Scientific) and specific primers (for ABCA1, 5’- CAGGCTACTACCTGACCTTGGT -3’ and 5’- CTGCTCTGAGAAACACTGTCCTC -3’; for GAPDH, 5’- GCACAGTCAAGGCTGAGAA -3’ and 5’- GCCAGTAGACTCCACAACATAC -3’) and quantified using the 2-Ct method.

    Article Title: FGFR inhibitors promote the autophagic degradation of IFN-γ-induced PD-L1 and alleviate the PD-L1-mediated transcriptional suppression of FGFR3-TACC3 in non-muscle-invasive bladder cancer.
    Article Snippet: Quantitative real-time PCR (qPCR) analysis was performed on a StepOne Real-Time PCR System (Thermo Fisher Scientific) using gene-specific primers (Supplementary Table S1) and the RealQ Plus 2X Master Green (A325402; Ampliqon, Odense, Denmark).

    Quantitative RT-PCR:

    Article Title: CIAO1 as a crucial signature gene of cuproptosis in gastric cancer
    Article Snippet: Reverse transcription was carried out using the Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics) with the following thermal protocol: 10 min at 65°C for primer annealing, 30 min at 55°C for reverse transcription, and 5 min at 85°C for enzyme inactivation. qPCR was performed using PowerUp SYBRTM Green Master Mix (Thermo Fisher Scientific, Inc.) on the StepOne Real-Time PCR System (Thermo Fisher Scientific, Inc.).

    Article Title: Prediction of long-term recurrence-free and overall survival in early-onset colorectal cancer: the ENCORE multi-centre study
    Article Snippet: In both cohorts, miRNA expression was assessed by RT-qPCR on a StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA) using the TaqMan miRNA probes (ThermoFisher Scientific, Supplementary Table ).

    Article Title: Neu1 sialidase regulates heterospecific social interaction in zebrafish via D1 dopamine receptor.
    Article Snippet: Gene expression levels were evaluated using a StepOne Real-Time PCR System (Thermo Fisher Scientific, Waltham, MA, USA).

    Article Title: Vagus nerve stimulation: a promising strategy to combat pyroptosis and inflammation in traumatic brain injury through the OX-A/NLRP3/caspase-1/GSDMD signaling pathway.
    Article Snippet: The amplification process was performed on cDNA (50 ng/μL) utilizing the StepOne Real-Time PCR System (Thermo Fisher Scientific), with SYBR Green PCR Master Mix in the presence of a specific primer pair (see Table 1) at 0.1 μM, according to the manufacturer’s instructions (TransGen Biotech).

    Article Title: SOX3 facilitates granulosa cell proliferation and suppresses cell apoptosis through modulating PI3K/AKT pathway by targeting SPP1.
    Article Snippet: Then the RNA samples were reverse transcribed using the RevertAid RT Reverse Transcription Kit (K1691, Thermo Fisher, USA) according to the manufacturer’s protocol. qRT-PCR assays were performed using SYBR Green qPCR Mix (D01010, GeneCopoeia, USA) in a StepOne real-time PCR system (Applied Biosystems, USA) following the routine protocol.

    Article Title: Effects of estrogen and mechanical loading on cultured cells derived from mandibular condylar cartilage.
    Article Snippet: The mRNA expression levels were measured using a StepOne Real-Time PCR System (Thermo Fisher Scientific). β-actin (used as an internal standard) and four target genes—IL-1β, MMP13, ADAMTS5, TIMP3, and COL2A1—were identified using the MCC method to assess the gene expression levels in response to the loading model. Primers were designed for 10 genes: collagen type I alpha 1 chain (COL1A1), collagen type III alpha 1 chain (COL3A1), collagen type IV alpha 1 chain (COL4A1), collagen type V alpha 1 chain (COL5A1), collagen type IV alpha 2 chain (COL4A2), collagen type IV alpha 5 chain (COL4A5), laminin subunit gamma 1 (LAMC1), heparan sulfate proteoglycan 2 (HSPG), laminin subunit beta 1 (LAMB1), and laminin subunit alpha 3 (LAMA3) (Fig. 5c, d).

    Article Title: The structural characteristics of cellular phospholipid acyl chains required for ABCA1-mediated HDL formation.
    Article Snippet: The expression level of ABCA1 mRNA was quantified using StepOne real-time PCR system (Applied Biosystems) with PowerUP SYBR Green Master Mix (Thermo Fisher Scientific) and specific primers (for ABCA1, 5’- CAGGCTACTACCTGACCTTGGT -3’ and 5’- CTGCTCTGAGAAACACTGTCCTC -3’; for GAPDH, 5’- GCACAGTCAAGGCTGAGAA -3’ and 5’- GCCAGTAGACTCCACAACATAC -3’) and quantified using the 2-Ct method.

    Article Title: FGFR inhibitors promote the autophagic degradation of IFN-γ-induced PD-L1 and alleviate the PD-L1-mediated transcriptional suppression of FGFR3-TACC3 in non-muscle-invasive bladder cancer.
    Article Snippet: Quantitative real-time PCR (qPCR) analysis was performed on a StepOne Real-Time PCR System (Thermo Fisher Scientific) using gene-specific primers (Supplementary Table S1) and the RealQ Plus 2X Master Green (A325402; Ampliqon, Odense, Denmark).



    Similar Products

    86
    Yeasen Biotechnology stepone real time pcr instrument
    Stepone Real Time Pcr Instrument, supplied by Yeasen Biotechnology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stepone+real-time+pcr+system/pcr+qpcr+quantitative+real+time/us12649712-1408-53-67
    Average 86 stars, based on 1 article reviews
    stepone real time pcr instrument - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    99
    Thermo Fisher stepone real time pcr machine
    Stepone Real Time Pcr Machine, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stepone+real-time+pcr+system/SUCROSE+EP%2FBP%2FNF+12KG/pm41806351-84-11-9
    Average 99 stars, based on 1 article reviews
    stepone real time pcr machine - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Roche stepone plus real time pcr system
    Stepone Plus Real Time Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stepone+real-time+pcr+system/LightCycler+480+System/pm41616688-150-11-16
    Average 99 stars, based on 1 article reviews
    stepone plus real time pcr system - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    96
    Thermo Fisher stepone plus real time pcr system
    Stepone Plus Real Time Pcr System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stepone+real-time+pcr+system/5%2C6-DIAMINOURACIL+SULFATE/pmc12911439-58-17-23
    Average 96 stars, based on 1 article reviews
    stepone plus real time pcr system - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    86
    Applied Biological Materials Inc stepone plus real time pcr system
    Stepone Plus Real Time Pcr System, supplied by Applied Biological Materials Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stepone+real-time+pcr+system/pcr+plus+real+stepone+system+time/pm41353884-143-32-37
    Average 86 stars, based on 1 article reviews
    stepone plus real time pcr system - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    99
    Thermo Fisher nd 2000 stepone plus real time pcr system applied biosystems
    Nd 2000 Stepone Plus Real Time Pcr System Applied Biosystems, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stepone+real-time+pcr+system/5%2C6-DIAMINOURACIL+SULFATE/pm41270737-817-206-212
    Average 99 stars, based on 1 article reviews
    nd 2000 stepone plus real time pcr system applied biosystems - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Thermo Fisher stepone plus real time pcr
    Stepone Plus Real Time Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stepone+real-time+pcr+system/5%2C6-DIAMINOURACIL+SULFATE/bio_rxiv__2025__11__07__687116-222-62-67
    Average 99 stars, based on 1 article reviews
    stepone plus real time pcr - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    90
    Thermo Fisher stepone plus real time pcr machine
    Stepone Plus Real Time Pcr Machine, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/stepone+real-time+pcr+system/steponeplustm+real+time+pcr+system/pmc12128615-206-19-25
    Average 90 stars, based on 1 article reviews
    stepone plus real time pcr machine - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results